To install StudyMoose App tap and then “Add to Home Screen”
Save to my list
Remove from my list
Matrix metalloproteinases (MMPs) are a family of at least 15 enzymes responsible for degrading the extracellular matrix (ECM).
The 2G allele represents a single nucleotide polymorphism (SNP) in the human MMP-1 promoter. This study investigates the impact of the MMP-1 SNP on transcriptional activity, protein/DNA binding, and its prevalence in normal fibroblasts and melanoma tumor cells. The MMP-1 promoter SNP in three cancer cell lines (MDA-MB-231, SiHa, and HepG2) was analyzed using PCR amplification and restriction digestion techniques. The restriction enzymes utilized were BglII and AlwI.
AlwI digests the 2G allele, leaving 1G intact (5'GGATC(N)43'). In contrast, BglII digests the 1G allele, leaving 2G intact (5'AGATCT3'). The initial step involves identifying the 1G/2G genotypes SNP in the MMP-1 promoter in these three cell lines. Ultimately, we determine the mRNA expression profiles of cell lines exhibiting MMP-1 SNPs phenotypically using reverse transcriptase polymerase chain reaction.
The family of metalloproteinases (MMPs) is responsible for degrading collagens and various other components of the extracellular matrix (ECM). Specifically, MMP-1 is involved in the degradation of type 1 collagen (1). Single nucleotide polymorphisms (SNPs) within the promoter region of MMP-1 have been associated with the upregulation of MMP-1 expression. This upregulation is significant because it has been linked to the metastasis of various invasive cancer types to other organs (3). Excessive expression of MMP-1 can result in damage to collagen-rich tissues, which can lead to pathological conditions, including the irreversible degradation of cartilage, tendons, and bone in conditions like arthritis (2).
Notably, the 2G/2G MMP-1 polymorphism has been correlated with cancer metastasis, suggesting its role in the formation of aggressive cancer types (4).
Understanding mRNA expression is crucial as it provides insights into protein levels. The promoter region plays a critical role in regulating gene transcription, mRNA stability, and translation, ultimately influencing protein production. Conversely, downregulation of mRNA can have a detrimental impact on protein levels and may be associated with abnormalities, including cancer (1).
The DNA extraction process involved obtaining DNA from three cell lines: HepG2, SiHa, and MDA-MB-231. Initially, 250μl of lysis buffer (0.05M Tris/0.02% SDS) and Proteinase K at a concentration of 0.1mg/ml (2.5µl of a 10mg/ml stock) were added to the cell pellets. These eppendorfs were then incubated at 37°C for 30 minutes. Following incubation, 50μl of the lysate was transferred to a 0.2ml tube and denatured in a thermal cycler at 95°C for 15 minutes.
A master mix of reagents was prepared for each cell line and a positive control, as detailed in Table-1:
| Volume for 1 reaction | Volume for n+1 reactions | |
|---|---|---|
| Sterile pure water | 25μl | (x7) 175 μl |
| 10 x AJ buffer | 5μl | (x7) 35 μl |
| Primer 1 (Forward) 2pmol/μl | 5μl | (x7) 35 μl |
| Primer 2 (Reverse) 2pmol/μl | 5μl | (x7) 35 μl |
| DNA | 5μl | |
| Taq 0.2U/μl | 5μl | |
| Final Volume | 50μl |
The PCR amplification cycle consisted of the following steps: 94°C for 30 seconds for denaturation, x°C for 30 seconds for primer annealing, and 72°C for 30 seconds for sequence extension. The annealing temperature for the MMP1 SNP primers was x = 55°C for the first three cycles, followed by annealing at x = 66°C for the subsequent 37 cycles.
The DNA samples were subjected to restriction digestion using AlwI and BglII enzymes. The volumes for a typical single reaction are presented in Table-2:
| Table-2: Restriction Digestion Reagent Volumes | |
|---|---|
| Aliquot both mastermixes into tubes, then add amplified DNA and mix the tubes before incubating for 1 to 16 hours at 37°C. | |
| Reagent | Volume for a Typical Single Reaction |
| Mastermix 1 (for AlwI) | xx μl |
| Mastermix 2 (for BglII) | yy μl |
| Amplified DNA | zz μl |
Following incubation, 2.5 μl of loading buffer was added to each restriction digest and positive control. Simultaneously, tubes containing 20 μl of the original PCR amplifications and a water control were prepared and had 2.5 μl of loading buffer added. Electrophoresis was conducted using a 3%(w/v) SeaKem / 1%(w/v) NuSieve agarose gel in 1× Tris/Borate/EDTA (TBE).
Direct Poly A+ mRNA Isolation from Cells Using the Dynabeads mRNA DIRECT Kit
The Dynabeads mRNA DIRECT kit employed an SDS/LiCl lysis buffer in which RNA remained stable for 30 minutes at room temperature without degradation by RNases.
For each cell line, 50μg/ml (12.5μl of 1mg/ml stock) of Proteinase K (PK) was added to 250μl of cell lysate (approximately 5 × 10^5 cells per lysate) in Lysis/Binding Buffer. The cell lysate with Proteinase K was then incubated for 30 minutes at 37°C to digest proteins and reduce viscosity. Further viscosity reduction was achieved through a DNA-shearing step involving the use of a needle.
100μl of each lysate was placed into a clean 1.5ml Eppendorf tube and kept on ice until needed for mRNA purification. 30µl of resuspended Dynabeads Oligo (dT)25 was added to each lysate (100µl). The mixture was incubated for 5 minutes at room temperature. The tube was then placed in a magnet, and once the suspension cleared, the supernatant was removed while keeping the tube in the magnet. Care was taken to avoid removing any beads. The beads were washed twice with Washing Buffer with SDS (WB + SDS) (60µl) at room temperature. The magnet was used to wash the beads two more times with washing buffer without SDS (WB – SDS). Finally, the beads were resuspended in 25µl sterile H2O and kept on ice.
Two reactions were set up for each mRNA preparation: a +RT (with reverse transcription) and a -RT (control) reaction. 15µl of +RT and -RT tubes were pipetted and 10µl aliquots were transferred into the appropriate set of + and - Eppendorfs, which were then kept on ice. The tubes were incubated at 42°C for 1 hour and the cDNA reaction tubes were stored at 4°C until needed for PCR.
PCR reactions were prepared for GAPDH (a housekeeping gene) and MMP1 to amplify the cDNA. Primer pairs had annealing temperatures of 60°C for both GAPDH and MMP1. GAPDH amplifications required 28 cycles, while MMP1 amplifications required 32 cycles. PCR products were analyzed by agarose gel electrophoresis using a 3%(w/v) SeaKem agarose gel in 1 x TAE buffer.
The PCR primer sequences used were as follows:
MMP F: GGAGTCACTTCAGTGGCAAGTGT
MMP R: TATATCTTGGATTGATTTGAGATAAGTCAGATC
The PCR products were subsequently analyzed through Restriction Digestion with Alw I and Bgl II enzymes.
The expected outcomes for Alw I digestion are as follows:
Result:
Based on the gel electrophoresis, the 231 cell line exhibited a homozygous G allele. HepG2 cell line was homozygous GG allele. SiHa was homozygous G. The control DNA showed a heterozygous G/GG allele as indicated by the presence of two bands. Gel lines 1, 2, 3, and 4 confirmed the specificity of MMPI primers to the target DNA, producing a 201 bp DNA fragment. Specifically, BglII restriction digestion provided conclusive results for most samples. However, additional analysis of the 10th lane was required to confirm the HepG2 allele.
Legend:
Polymerase chain reaction (PCR) products were digested with AlwI and BglII restriction endonucleases and separated on a 3% Seakem agarose gel and 1% Nusieve agarose gel. The ethidium bromide-stained gel was visualized using UV transillumination.
The expected outcomes for Bgl II digestion are as follows:
Result:
Based on the gel electrophoresis, the 231 cell line exhibited a homozygous G allele. HepG2 cell line was homozygous GG allele. SiHa was homozygous G. The control DNA showed a heterozygous G/GG allele as indicated by the presence of two bands. This analysis demonstrated that the MMPI primers are specific to the target DNA, producing a 201 bp DNA fragment.
The results of the analysis of MMP-1 mRNA expression for the three cell lines provide valuable insights into the performance of various components of the experiment.
GAPDH mRNA Expression (2nd, 3rd, and 4th lanes):
The presence of bands in the 2nd, 3rd, and 4th lanes indicates successful detection of the housekeeping gene GAPDH mRNA expression. This outcome confirms the integrity and functionality of all reagents, RT-PCR steps, and primers used in the experiment.
MMP-1 mRNA Expression (5th, 6th, and 7th lanes):
Notably, the 5th lane (231 cell line) demonstrates robust MMP-1 mRNA expression, as evidenced by the clear band. However, the 6th and 7th lanes (HepG2 and SiHa cell lines, respectively) exhibit relatively lower levels of MMP-1 mRNA expression when compared to the 5th lane.
GAPDH and MMP-1 Negative Controls (8th to 13th lanes):
The 8th, 9th, and 10th lanes represent negative controls for GAPDH, where the RT- step was performed. These lanes show no bands, confirming that the primers did not amplify genomic DNA. Similarly, the 11th, 12th, and 13th lanes represent negative controls for MMP-1, also with the RT- step. These lanes demonstrate the absence of bands, further confirming the specificity of the primers for mRNA.
Analysis of MMP-1 mRNA expression levels were made in the three cell lines. Reverse transcriptase polymerase chain reaction (RT-PCR) products were digested with AlwI and BglII restriction endonucleases and separated on a 3% Seakem agarose gel. Visualization was achieved using UV transillumination.
The findings from our study shed light on the genetic and molecular characteristics of MMP-1 in three different cell lines—HepG2, SiHa, and MDA-MB-231. The investigation into MMP-1 promoter polymorphism revealed important insights into the genetic diversity of this critical gene in the context of cancer metastasis and tissue degradation.
Our analysis of MMP-1 1G/2G polymorphism using AlwI and BglII restriction enzymes provided valuable information about the allelic variations present in the cell lines. Notably, we observed distinct patterns in the electrophoretic gels, suggesting different genotypes for MMP-1. The presence of homozygous GG alleles in the HepG2 cell line and homozygous G alleles in the SiHa cell line, as well as a heterozygous G/GG allele in the control DNA, demonstrated the utility of our molecular assays in identifying genetic variations associated with MMP-1.
Furthermore, our study delved into mRNA expression levels of MMP-1 and the housekeeping gene GAPDH in these cell lines. The RT-PCR results indicated varying levels of MMP-1 mRNA expression across the cell lines, with the 231 cell line exhibiting robust expression compared to HepG2 and SiHa. These findings suggest that MMP-1 may play a role in the molecular mechanisms underlying the metastatic potential of these cells. Additionally, the successful amplification of GAPDH mRNA in all cell lines validated the accuracy and reliability of our experimental procedures.
Our negative control experiments further confirmed the specificity of the MMP-1 primers for mRNA. The absence of bands in the -RT lanes for MMP-1 indicated that genomic DNA contamination was minimal, ensuring the accuracy of our mRNA expression data.
In conclusion, our study provides a comprehensive analysis of MMP-1 genetic polymorphism and mRNA expression levels in HepG2, SiHa, and MDA-MB-231 cell lines. The identification of MMP-1 genotypes and varying mRNA expression levels highlights the potential significance of MMP-1 in cancer metastasis and tissue degradation. These findings may have implications for understanding the molecular mechanisms driving aggressive cancer types and the development of targeted therapies.
Our experimental approach, including DNA extraction, PCR, restriction digestion, and RT-PCR, proved effective in characterizing MMP-1 polymorphism and gene expression. The negative controls assured the specificity of our assays and the reliability of the results.
This study contributes to the growing body of knowledge on MMP-1 genetics and its potential role in cancer progression. Further research and clinical investigations are warranted to elucidate the precise mechanisms by which MMP-1 influences cancer metastasis and to explore potential therapeutic interventions based on these insights.
Three Cell Line Genotype and mRNA Expression. (2024, Jan 23). Retrieved from https://studymoose.com/document/three-cell-line-genotype-and-mrna-expression
👋 Hi! I’m your smart assistant Amy!
Don’t know where to start? Type your requirements and I’ll connect you to an academic expert within 3 minutes.
get help with your assignment