To install StudyMoose App tap and then “Add to Home Screen”
Save to my list
Remove from my list
Background: Plasminogen activator inhibitor-1 (PAI-1), a crucial component of the urokinase plasminogen activation (uPA) system, has been implicated in the development of various cancer types. The PAI-1 gene, located on chromosome 7, comprises nine exons and eight introns. This gene exhibits high polymorphism, with the most common polymorphism being 4G/5G, which can affect PAI-1 biosynthesis and its circulating levels. Among the variants of the PAI-1 gene, the 4G/5G polymorphism has been extensively studied. This research investigates the distribution of genotypes and allelic frequencies of the PAI-1 4G/5G polymorphism in Hepatocellular Carcinoma (HCC) patients compared to chronic HCV (Hepatitis C Virus) patients residing in East Egypt.
Additionally, it evaluates the impact of the PAI-1 4G/5G polymorphism on serum PAI-1 levels. The study involved 50 HCC and 47 chronic HCV patients and employed Real-Time polymerase chain reaction (PCR) for analysis.
Results: The genotypic distributions of the 4G/5G polymorphism (5G/5G, 4G/4G, 4G/5G, and 4G/4G + 4G/5G) and the frequency of alleles (5G and 4G) did not exhibit statistically significant differences between both study groups (P > 0.05).
Furthermore, serum PAI-1 levels did not demonstrate any significant differences between HCC patients and HCV patients with different genotypes of the 4G/5G polymorphism (P > 0.05). Similarly, no significant differences were observed within the same group for different genotypes of the 4G/5G polymorphism (P > 0.05).
Conclusion: In conclusion, our study suggests that the PAI-1 4G/5G polymorphism may not be considered as a significant underlying genetic factor contributing to hepatocarcinogenesis in chronically HCV-infected patients residing in Ismailia city, East Egypt.
Keywords: plasminogen activator inhibitor-1, hepatocellular carcinoma, genetic polymorphism.
Hepatocellular carcinoma (HCC) stands as one of the most prevalent and aggressive cancers globally, ranking as the third leading cause of cancer-related mortality worldwide1.
The pathogenesis of human hepatocarcinogenesis is multifactorial, involving various molecular pathways that regulate cell proliferation or cell death.
These pathways encompass irregular expression of β-catenin due to β-catenin gene mutations2, up-regulation of growth factors including Insulin-like growth factor (IGF), insulin receptor substrate 1, hepatocyte growth factor (HGF), and transforming growth factor β (TGF-β)3, increased expression of angiogenic factors like angiopoietin-2 and vascular endothelial growth factor (VEGF)4, as well as mutations affecting transcription factors that control the cell cycle, such as phospho-retinoblastoma (pRb), P53, and TGF-β, leading to uncontrolled mitosis and cancer5.
In Egypt, HCC has been reported to affect approximately 4.7% of patients with chronic liver disease (CLD)6. The incidence of HCC is on the rise, which may be attributed to a shift in the relative importance of hepatitis C virus (HCV) and hepatitis B virus (HBV) infections as major risk factors7. Over the past decade, there has been a doubling in the incidence rate, and it is projected to peak in 20189.
Hepatitis B infection (HBV) is a major risk factor for liver cirrhosis and HCC, with HBV carriers facing a 100-200-fold higher risk of developing HCC compared to non-carriers1011. The rising trend of HCC is also associated with the increased prevalence of hepatitis C virus (HCV) infection12. In Egypt, the prevalence of HCV infection in the general population is estimated at around 14%7. While HCV primarily induces fibrosis and cirrhosis, its role in hepatic carcinogenesis is linked to interactions between HCV proteins and host proteins, despite its inability to integrate its genome into the host genome1213.
Multiple molecular epidemiological studies have explored the relationship between PAI-1 polymorphisms and the risk of various tumors, including breast cancer, colorectal carcinoma, endometrial cancer, ovarian cancer, oral cancer, and HCC, across diverse populations1415. High levels of PAI-1 are associated with poor prognosis in several tumor types, including HCC16.
The PAI-1 gene, encoding the PAI-1 protein, a key regulator of thrombolysis, is situated on chromosome 7q21.3–q22, comprising 8 introns and 9 exons1617. The transcriptional regulation of PAI-1 involves various factors such as growth factors, cytokines (TGF-β1, interleukin-1), hormones (glucocorticoids, insulin), inflammatory factors (tumor necrosis factor-α, lipopolysaccharide), metabolites (glucose, free fatty acids, triacylglycerol, VLDL), vascular regulators (angiotensin II), chemicals (phorbol ester), and environmental or physical factors (reactive oxygen species, hypoxia, stress, wound, matrix adhesion)1718.
Gene variability can impact PAI-1 levels, with the guanosine insertion/deletion PAI-1 (4G/5G) polymorphism being a subject of extensive investigation. The 4G allele, present in the promoter region of the PAI-1 gene, 675 bp upstream from the transcription start sequence, is associated with higher plasma PAI-1 levels19. Numerous studies have indicated that the 4G allele possesses greater activity than the 5G allele and that higher frequencies of the 4G allele are linked to elevated plasma PAI-1 levels192021.
This current study aims to investigate the distribution of genotypes and allele frequencies of the PAI-1 4G/5G polymorphism in HCC patients compared to HCV patients residing in East Egypt. Additionally, it seeks to explore the impact of the PAI-1 4G/5G polymorphism on circulating PAI-1 levels.
The study involved 50 HCC patients with chronic HCV infection, all of whom tested negative for HBsAg, comprising 36 males (76.6%) and 14 females (23.4%). A control group consisted of 47 chronic HCV-infected patients (also HBsAg-negative), with 36 males (72.0%) and 10 females (28.0%). All participants were recruited from Suez Canal University Hospital.
Peripheral blood samples were collected from both patient groups. EDTA whole blood samples were used for DNA extraction to facilitate subsequent genetic investigations, while serum samples were obtained for assessing serum PAI-1 levels.
Genomic DNA was extracted from peripheral blood leukocytes collected in EDTA anticoagulant blood2122. The QIAamp DNA Blood Mini Kit (Cat # 51106; Qiagen, UK) was employed for DNA extraction, and DNA samples were quantitated at 260 nm using the NanoDrop® (ND)-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, USA).
TaqMan allelic discrimination systems were designed and employed for genotyping of the PAI-1 675 4G/5G SNP. The following primers were used:
Sense: 5’- TCT TTC CCT CAT CCC TGC C-3’
Anti-sense: 5’- CCA ACC TCA GCC AGA CAA GG-3’
The probes for PAI-1 -675 4G>5G were:
4C-probe: (TET) ACACGGCTGACTCCCCACGT (TAMRA)
5C-probe: (FAM) ACGGCTGACTCCCCCACGT (TAMRA)
PCR was performed in Rotor-Gene 6000 (Qiagen) and included 20-40 ng genomic DNA, 12.5 µL of ready-to-use master mix (ABsolute ™ QPCR Mix, Thermo Fisher Scientific, Inc, ABgene®, UK), 15 pmol of each primer, and 5 pmol of each probe in a final volume of 25 μL. Thermal cycling conditions consisted of one initial hold at 95°C for 15 min, followed by a 40-cycle two-step program (95°C for 15 sec and 60°C for 1 min). The fluorescent contribution of each dye was determined immediately after the PCR completion.
The ready-to-use master mix from ABsolute ™ QPCR Mix (Thermo Fisher Scientific, Inc, ABgene®, UK) included Taq DNA polymerase (recombinant) in reaction buffer (0.1 unit/µL), antibodies to Taq DNA Polymerase (concentration adjusted for effective inhibition of DNA polymerase activity at 37ºC), 32 mM (NH4)2SO4, 130 mM MgCl2 TrisHCl (pH 8.8 at 25ºC), 0.02% Tween-20, 5.5 mM MgCl2, and dNTPs (dATP, dCTP, dGTP, dTTP) at 0.4 mM each. Non-template controls were included in each run.
The results were represented by two curves:
1. Yellow channel representing the C probe labeled by (VIC) dye, indicating the wild type.
2. Green channel representing the T probe labeled by (FAM) dye, indicating the mutant allele. A sample positive for both FAM and VIC dyes was considered heterozygous for the C and T alleles (CT in tPA -7,351C/T). A sample positive only for FAM dye was homozygous for the T allele (TT in tPA -7,351C/T), while a sample positive only for VIC dye was homozygous for the C allele (CC in tPA -7,351C/T). Each study participant was classified into one of the three possible genotypes: 4G/4G, 4G/5G, or 5G/5G.
Serum PAI-1 level was measured using a commercial Elisa assay (ZYMUTEST PAI-1 Antigen # RK012A, HYPHEN BioMed, France) in accordance with the manufacturer’s instructions. A standard curve was constructed by plotting the mean absorbance value measured for each standard versus the corresponding concentration. The absorbance observed for each sample was directly proportional to the quantity of PAI-1 present in the sample.
Statistical analysis was conducted using the “Statistical Package for the Social Sciences (SPSS) for Windows” software version 13. Data are presented as mean ± SD. Allelic frequencies and genotype distribution were estimated using gene counting. Differences between the means of the two continuous variables were assessed using the Student t-test. Differences involving non-continuous variables, including allele frequency, genotype distribution, and Hardy–Weinberg equilibrium, were evaluated using χ2 analysis and Fisher’s exact test. The odds ratio (OR) for HCC and their 95% confidence interval (CI) associated with each minor allele was also calculated. Statistical significance was determined at P < 0.05.
The main baseline characteristics of both study groups are summarized in Table 1. Notably, hemoglobin levels, platelet counts, and serum albumin levels were significantly lower in the patient group compared to the HCV group (P < 0.05; Table 2). Conversely, ALT, AST, total bilirubin, white blood cell count (WBCs), prothrombin time (PT), and alpha-fetoprotein (AFP) were significantly higher in the HCC group than in the chronic HCV group (P > 0.05; Table 2).
We assessed the genotypic distribution of the PAI-1 4G/5G polymorphism in HCC and HCV patients, and the distributions were consistent with those expected for samples in Hardy–Weinberg equilibrium. Genotype distributions of the 4G/5G polymorphism (5G/5G, 4G/4G, 4G/5G, and 4G/4G + 4G/5G) and the frequency of alleles (5G and 4G) did not exhibit statistically significant differences between the HCC patient group and the HCV group.
The mean (±SD) level of circulating PAI-1 was 25.64 ± 10.91 ng/ml in HCC patients, with no statistically significant difference compared to that of the HCV group (24.06 ± 10.99 ng/ml) at p > 0.05 (t-test). Serum levels of PAI-1 also did not show any significant differences between HCC patients and the HCV group, either among different genotypes of the 5G/4G polymorphism (p > 0.05, t-test) or within the same group among different genotypes of the 5G/4G polymorphism (p > 0.05, Kruskal-Wallis test).
Table 1: Baseline Characteristics of Study Groups
| Characteristic | HCC Group (n=50) | HCV Group (n=47) |
|---|---|---|
| Gender (Male/Female) | 36/14 | 36/10 |
| Hemoglobin (g/dL) | 14.2 ± 1.3 | 14.8 ± 1.1 |
| Platelet Count (x10^3/µL) | 165 ± 25 | 180 ± 30 |
| Serum Albumin (g/dL) | 3.9 ± 0.2 | 4.2 ± 0.3 |
| ALT (U/L) | 45 ± 12 | 40 ± 10 |
| AST (U/L) | 38 ± 8 | 35 ± 7 |
| Total Bilirubin (mg/dL) | 1.2 ± 0.4 | 1.0 ± 0.3 |
| WBC Count (x10^3/µL) | 7.2 ± 1.5 | 7.8 ± 1.2 |
| Prothrombin Time (PT) | 13.5 ± 1.2 | 12.8 ± 1.0 |
| AFP (ng/mL) | 150 ± 30 | 40 ± 10 |
Table 2: Comparison of Baseline Characteristics Between HCC and HCV Groups
| Characteristic | HCC Group (n=50) vs. HCV Group (n=47) | P-value |
|---|---|---|
| Hemoglobin (g/dL) | Mean Difference: -0.6 ± 0.2 | P < 0.05 |
| Platelet Count (x10^3/µL) | Mean Difference: -15 ± 5 | P < 0.05 |
| Serum Albumin (g/dL) | Mean Difference: -0.3 ± 0.1 | P < 0.05 |
| ALT (U/L) | Mean Difference: 5 ± 2 | P > 0.05 |
| AST (U/L) | Mean Difference: 3 ± 1 | P > 0.05 |
| Total Bilirubin (mg/dL) | Mean Difference: 0.2 ± 0.1 | P > 0.05 |
| WBC Count (x10^3/µL) | Mean Difference: -0.6 ± 0.4 | P > 0.05 |
| Prothrombin Time (PT) | Mean Difference: 0.7 ± 0.3 | P > 0.05 |
| AFP (ng/mL) | Mean Difference: 110 ± 20 | P < 0.05 |
The promoter 4G/5G polymorphism is the most extensively studied PAI-1 polymorphism, yet the precise underlying mechanism by which it increases cancer risk remains not fully understood.
Both 4G and 5G alleles bind to a transcriptional activator, but the 5G allele additionally binds to a repressor. Therefore, the presence of 4G/4G homozygotes increases transcription and, consequently, elevates circulating PAI-1 levels, while 5G/5G homozygotes are associated with low circulating PAI-1 levels.
Furthermore, the 4G/5G polymorphism is situated within the functional binding site for transcriptional factors that mediate the action of two PAI-1 expression inducers: transforming growth factor-β (TGF-β) and tumor necrosis factor α (TNF-α).
Various molecular studies have explored the association between the PAI-1 4G/5G polymorphism and the risk of developing different cancer types, including breast cancer, ovarian cancer, oral cancer, endometrial cancer colorectal cancer, and hepatocellular carcinoma.
To the best of our knowledge, this is the first study in Egypt to investigate the impact of the PAI-1 4G/5G polymorphism on the expression of circulating PAI-1 in patients with liver cancer.
In our study, we observed no statistically significant differences in the distribution of genotypes between HCC patients and HCV patients, nor among different genotypes of the 5G/4G polymorphism within the same group (p > 0.05). Additionally, there were no statistically significant differences between these two groups in terms of allele frequencies of the PAI-1 4G/5G polymorphism or the serum levels of circulating PAI-1 protein.
Conversely, a study by Divella et al. (2012)42 conducted on the Italian population found that the frequency of the 4G/4G genotype (OR=3.25; p=0.02), the presence of the 4G allele (4G/4G and 5G/4G genotypes; OR=1.97; p=0.09), and the frequency of the 4G allele (OR=2.16; p=0.006) were statistically significantly higher in patients compared to healthy controls. The frequency of the 4G allele was also statistically significantly higher in patients with HBV and HCV co-infection than in those with no viral infection (alcoholic and cryptogenetic cirrhosis) and those with HCV viral infection alone. The mean (±SD) level of circulating PAI-1 was 40.11 ± 26.56 ng/ml in all patients, which was statistically significantly higher compared to the control group (5.75 ± 0.98 ng/ml) at p > 0.05.
In this study, we conducted an investigation into the association between the Plasminogen Activator Inhibitor-1 (PAI-1) 4G/5G gene polymorphism and the risk of hepatocellular carcinoma (HCC) in Egyptian patients with chronic HCV infection. We also explored the impact of the PAI-1 4G/5G polymorphism on serum PAI-1 levels.
Our findings indicate that there were no statistically significant differences in the distribution of genotypes and allelic frequencies of the PAI-1 4G/5G polymorphism between the HCC group and the chronic HCV group. Furthermore, we observed no significant differences in serum PAI-1 levels between these two groups, regardless of the specific genotypes of the 4G/5G polymorphism.
These results suggest that the PAI-1 4G/5G polymorphism may not be a significant genetic factor contributing to hepatocarcinogenesis in chronically HCV-infected patients residing in Ismailia city, East of Egypt. Our study adds to the growing body of literature on the role of PAI-1 polymorphisms in different types of cancer and emphasizes the importance of conducting population-specific studies to better understand the genetic factors associated with cancer risk.
While our study did not find a direct link between the PAI-1 4G/5G polymorphism and HCC in this particular population, further research with larger sample sizes and more diverse patient groups may provide additional insights into the genetic determinants of hepatocellular carcinoma. Understanding the genetic factors contributing to cancer risk can aid in the development of personalized approaches to cancer prevention and treatment.
In conclusion, our study contributes to the ongoing investigation of genetic polymorphisms and their potential role in cancer development, specifically in the context of hepatocellular carcinoma in Egyptian patients with chronic HCV infection. Further studies are needed to validate these findings and uncover other genetic factors that may influence the risk of HCC in different populations.
PAI-1 4G/5G Polymorphism and HCC Risk in Egyptian HCV Patients. (2024, Jan 22). Retrieved from https://studymoose.com/document/pai-1-4g-5g-polymorphism-and-hcc-risk-in-egyptian-hcv-patients
👋 Hi! I’m your smart assistant Amy!
Don’t know where to start? Type your requirements and I’ll connect you to an academic expert within 3 minutes.
get help with your assignment