To install StudyMoose App tap and then “Add to Home Screen”
Save to my list
Remove from my list
Cancer is a sudden abnormal growth of cells in the human body due to cell division (1Cooper.GM, "The Development and Causes of Cancer"). This abnormal growth that begins in the colon is known as colon cancer, also referred to as colorectal cancer. The colon forms a muscular cylindrical-shaped organ known as the large intestine (2NCI Dictionary of Cancer Terms, National Cancer Institute), and the large intestine is a crucial component of the digestive system, spanning from the colon to the anus (3Kapoor et al., 2011).
One of the vital functions of the colon is to digest and absorb nutrients from food.
The primary cause of colon cancer, or colorectal cancer, is a mutation in the Adenomatous polyposis coli gene (APC) (4Aghabozorgi, A et al., 2019). Adenomatous polyposis coli (APC) is a protein encoded by the APC gene, which plays a pivotal role in various cellular processes. One of its essential functions is acting as a tumor suppressor, preventing cells from proliferating excessively or in an uncontrolled manner.
When the APC gene undergoes mutation, the APC protein loses its ability to function effectively as a tumor suppressor, ultimately contributing to the development of colon cancer (5Polakis P, 1997).
Familial Adenomatous Polyposis (FAP) is a condition caused by genetic abnormalities in the APC gene located on chromosome 5q21. FAP is characterized by the abnormal growth of adenomatous polyps, and if left untreated, it can progress to cancer. FAP is relatively common and severe (6Claes et al., 2011; 7Croner.S et al., 2005).
Furthermore, the APC gene has been shown to interact with β-catenin, a multifunctional protein.
Loss of APC activity leads to the overproduction of β-catenin, which is a key component of the Wnt signaling pathway (8Clevers et al., 2006). In the context of colon cancer development, increased activity of APC induces the degradation of β-catenin, serving as a negative regulator of the Wnt signaling pathway. Prolonged accumulation of β-catenin in APC-mutated colon cancer cells results in continuous stimulation of the Wnt pathway, contributing to cancer progression (5Polakis P, 1997).
| Patient | Codon | Allele 1 | Allele 2 |
|---|---|---|---|
| Patient X | 280 | TCA | TGA |
| Father | 280 | TCA | TCA |
| Mother | 280 | TCA | TGA |
A mutation is observed in allele 2 of the mother and the patient, indicating allele 1 as the pre-mutation state and allele 2 as the post-mutation state.
| Patient | Codon | Allele 1 | Allele 2 |
|---|---|---|---|
| Patient X | 280 | TCA | TGA |
| Father | 280 | TCA | TCA |
| Mother | 280 | TCA | TGA |
1. At 18 years old, a histopathological section of a colon biopsy from Patient X revealed normal colon tissue with no abnormalities, suggesting no signs of cancer development. The sample exhibited numerous goblet cells lining the crypt, lymphoid tissue near the submucosa, and the absence of polyps, indicating a normal colonic mucosa.
2. At 40 years old, another histopathological section of a colon biopsy from Patient X displayed colon tissue with adenomatous polyps, characterized by their round and tubular shape, indicative of tubular adenoma. This suggests a change in histology over time, and the presence of benign polyps raises the possibility of further growth.
3. In the immunofluorescence study, it was observed that Figure 2b displayed notably higher levels of beta-catenin fluorescence in comparison to Figure 2a. This heightened fluorescence indicates an accumulation of beta-catenin within the cells, suggesting potential cellular changes.
4. The western blot analysis depicted in Figure 3 revealed that cyclin D1 exhibited a more pronounced expression in Figure B when compared to Figure A. The control, GAPDH, confirmed the overexpression of cyclin D1, a marker often associated with cancer-related processes.
5. In Figure 4, specifically Figure B, the immunohistochemistry results exhibited a positive stain, indicating a substantial level of Ki67 expression. Elevated Ki67 expression is commonly associated with increased tumor aggressiveness and a diminished likelihood of survival (9Brown et al., 2002). It is noteworthy that Ki67 expression is typically observed in the G1, S, G2, and M phases of the cell cycle, excluding the G0 phase (10Shirendeb U et al., 2009).
The table below illustrates a higher count of Ki67 positive nuclei in the patient's biopsy at 40 years old compared to the biopsy at 18 years old.
| Age | Ki67 Positive Nuclei Count |
|---|---|
| 18 | 14 |
| 40 | 45 |
The table below presents the distribution of Ki67 positive nuclei in patient X's biopsies at 18 and 40 years old, highlighting notable changes in the quartiles:
| Age (Years) | Lower Quartile (LQ) | Upper Quartile (UQ) |
|---|---|---|
| 18 | 9.25 | 15.75 |
| 40 | 37.5 | 49.5 |
The table provides a clear comparison of the lower and upper quartiles for Ki67 positive nuclei at different ages, highlighting the substantial increase in the number of Ki67 positive nuclei at 40 years old.
The table below presents the current DNA sequence of patient X's APC1 gene, highlighting a point mutation in codon 280 and codon 1338:
| Codon | Allele 1 | Allele 2 |
|---|---|---|
| 280 | TCA | TGA |
| 1338 | TAG | CAG |
In codon 280, a mutation is observed due to changes in the mother's allele, leading to an inherited germline mutation. Codon 1338 exhibits a somatic mutation that occurred at 40 years old, resulting in a higher likelihood of developing polyps. Codon 280 represents a germline mutation and is classified as a nonsense point mutation (11Nishisho et al., 1997). It is an autosomal disease, meaning that a mutation in the allele can lead to the disease.
Here is the full DNA sequence of allele 1 from patient X:
ATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTACAGTCCCAAGCAACA GAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAG AATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCA ACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCA CCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA CATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG GCCAGGGCCAGTGCAGCACTCCACAACATCATTCACTCACAGCCTGATGACAAGAGAGGC AGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGCGCTTACTGTGAAACCTGT TGGGAGTGGCAGGAAGCTCATGAACCAGGCATGGACCAGGACAAAAATCCAATGCCAGCT CCTGTTGAACATTAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTTGATGAA GAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTATTGCAA GTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGACGATAT GCTGGAATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAGGCTACGCTATGC TCTATGAAAGGCTGCATGAGAGCACTTGTGGCCCAACTAAAATCTGAAAGTGAAGACTTA
Patient X exhibited a family history of colon cancer, raising concerns about their susceptibility to developing colorectal cancer, as it can be inherited (12El Fakir S et al., 2013). The presence of symptoms and the development of polyps, as shown in Figures 1a and 1b, strongly suggested Familial Polyposis Coli (FAP), an inherited condition.
The APC gene, known as a tumor suppressor gene, can lead to Familial Polyposis Coli (FAP) when mutations occur. A BLAST search tool was employed to analyze the provided genetic sequence. BLAST searches compare biological sequence information, such as amino acid sequences of proteins or nucleotides in DNA/RNA sequences. In this case, BLASTX was utilized to analyze amino acid sequences. The BLAST results identified the sequence as "Adenomatous polyposis coli protein isoform h (Homo sapiens)" with a mutation indicated by an asterisk. Patient X's mutation in the base led to the absence of codon q, resulting in the absence of the amino acid alanine.
The highlighted sequence segment above reveals a mutation, specifically a stop codon (TAG), indicating that everything following TAG will not be transcribed. This results in the production of a shortened protein. Additionally, there is a mutation in Table 1 where TCA point mutates to TGA. TCA normally codes for a serine amino acid, and a mutation of this codon can lead to the development of osteoma of the mandible, a condition linked to Gardner's syndrome. Gardner's syndrome is characterized by the presence of colon polyps and tumors external to the colon.
The results from the BLAST analysis suggest that the patient may inherit colon cancer due to mutations in the Adenomatous polyposis coli protein, a tumor suppressor. When mutated, this gene cannot effectively protect against tumors and carry out its function properly. Additionally, codon 1338's somatic mutation indicates a potential influence of external factors.
Figure 1b displays a tubular adenoma and the presence of a polyp in the histopathological section, indicating that the patient has developed polyps and is at an increased risk of developing colon cancer (13Markowitz et al., 2009). This observation is further supported by Figure 2, an immunofluorescence figure that illustrates beta-catenin levels through fluorescence. Increased fluorescence indicates higher levels of beta-catenin. Mutated APC allows the destruction complex to inactivate proteins by attaching ubiquitin and disintegrating beta-catenin into the proteasome. The elevated beta-catenin levels in Figures 4 and 3 suggest increased cell proliferation. The sudden increase in Ki67, as shown in Figure 4b, is associated with cancer aggressiveness, indicating an increased risk of cancer development.
A box plot was generated to determine the median number of Ki67 positive nuclei between the patient at 18 and 40 years old. The results presented in Table 2 reveal a significant increase in the number of Ki67 positive nuclei when the patient is 40 years old. The difference between the upper quartiles for both ages is 35, with the patient at 40 having a significantly higher upper quartile (53) compared to 18 (18). Comparing the medians, the median at 40 years old (41.7) is higher than at 18 years old (12.1).
Based on the gathered information, it is apparent that the patient is at a high risk of developing colon cancer, particularly given their family history and the presence of polyps. Treatment options include colonoscopy, sigmoidoscopy, and the Cologuard test, which uses blood to detect abnormalities.
In conclusion, the findings indicate that the patient is at an elevated risk of developing colon cancer. However, these mutations appear to be short-lived. If left untreated, the polyps may progress, increasing the likelihood of colon cancer development.
Genetic Mutations and Colon Cancer Risk. (2024, Jan 24). Retrieved from https://studymoose.com/document/genetic-mutations-and-colon-cancer-risk
👋 Hi! I’m your smart assistant Amy!
Don’t know where to start? Type your requirements and I’ll connect you to an academic expert within 3 minutes.
get help with your assignment