Genetic Mutations and Colon Cancer Risk

Essay, Pages 8 (1802 words)

Views

Introduction

Cancer is a sudden abnormal growth of cells in the human body due to cell division (¹Cooper.GM, "The Development and Causes of Cancer"). This abnormal growth that begins in the colon is known as colon cancer, also referred to as colorectal cancer. The colon forms a muscular cylindrical-shaped organ known as the large intestine (²NCI Dictionary of Cancer Terms, National Cancer Institute), and the large intestine is a crucial component of the digestive system, spanning from the colon to the anus (³Kapoor et al., 2011).

One of the vital functions of the colon is to digest and absorb nutrients from food. The primary cause of colon cancer, or colorectal cancer, is a mutation in the Adenomatous polyposis coli gene (APC) (⁴Aghabozorgi, A et al., 2019). Adenomatous polyposis coli (APC) is a protein encoded by the APC gene, which plays a pivotal role in various cellular processes. One of its essential functions is acting as a tumor suppressor, preventing cells from proliferating excessively or in an uncontrolled manner.

When the APC gene undergoes mutation, the APC protein loses its ability to function effectively as a tumor suppressor, ultimately contributing to the development of colon cancer (⁵Polakis P, 1997).

Familial Adenomatous Polyposis (FAP) is a condition caused by genetic abnormalities in the APC gene located on chromosome 5q21. FAP is characterized by the abnormal growth of adenomatous polyps, and if left untreated, it can progress to cancer. FAP is relatively common and severe (⁶Claes et al., 2011; ⁷Croner.S et al., 2005).

Furthermore, the APC gene has been shown to interact with β-catenin, a multifunctional protein.

Loss of APC activity leads to the overproduction of β-catenin, which is a key component of the Wnt signaling pathway (⁸Clevers et al., 2006). In the context of colon cancer development, increased activity of APC induces the degradation of β-catenin, serving as a negative regulator of the Wnt signaling pathway. Prolonged accumulation of β-catenin in APC-mutated colon cancer cells results in continuous stimulation of the Wnt pathway, contributing to cancer progression (⁵Polakis P, 1997).

Patient Genetic Information

Patient	Codon	Allele 1	Allele 2
Patient X	280	TCA	TGA
Father	280	TCA	TCA
Mother	280	TCA	TGA

Results

Table 1: Germ Line Mutations in APC1 in Patient X and Parents

A mutation is observed in allele 2 of the mother and the patient, indicating allele 1 as the pre-mutation state and allele 2 as the post-mutation state.

Patient	Codon	Allele 1	Allele 2
Patient X	280	TCA	TGA
Father	280	TCA	TCA
Mother	280	TCA	TGA

Histopathological Sections of Colon Biopsies of Patient X

1. At 18 years old, a histopathological section of a colon biopsy from Patient X revealed normal colon tissue with no abnormalities, suggesting no signs of cancer development. The sample exhibited numerous goblet cells lining the crypt, lymphoid tissue near the submucosa, and the absence of polyps, indicating a normal colonic mucosa.

2. At 40 years old, another histopathological section of a colon biopsy from Patient X displayed colon tissue with adenomatous polyps, characterized by their round and tubular shape, indicative of tubular adenoma. This suggests a change in histology over time, and the presence of benign polyps raises the possibility of further growth.

Immunofluorescence Images of Patient X's Cells Stained with Antibodies to Beta-Catenin

3. In the immunofluorescence study, it was observed that Figure 2b displayed notably higher levels of beta-catenin fluorescence in comparison to Figure 2a. This heightened fluorescence indicates an accumulation of beta-catenin within the cells, suggesting potential cellular changes.

Western Blotting of Patient X's Cells for Cyclin D1 Expression

4. The western blot analysis depicted in Figure 3 revealed that cyclin D1 exhibited a more pronounced expression in Figure B when compared to Figure A. The control, GAPDH, confirmed the overexpression of cyclin D1, a marker often associated with cancer-related processes.

Immunohistochemistry Images of Patient X's Biopsies Stained with Antibodies to Ki67

5. In Figure 4, specifically Figure B, the immunohistochemistry results exhibited a positive stain, indicating a substantial level of Ki67 expression. Elevated Ki67 expression is commonly associated with increased tumor aggressiveness and a diminished likelihood of survival (⁹Brown et al., 2002). It is noteworthy that Ki67 expression is typically observed in the G1, S, G2, and M phases of the cell cycle, excluding the G0 phase (¹⁰Shirendeb U et al., 2009).

Table 2: Number of Ki67 Positive Nuclei

The table below illustrates a higher count of Ki67 positive nuclei in the patient's biopsy at 40 years old compared to the biopsy at 18 years old.

Age	Ki67 Positive Nuclei Count
18	14
40	45

Box Plots for Patient's Biopsies at 18 and 40 Years Old

The table below presents the distribution of Ki67 positive nuclei in patient X's biopsies at 18 and 40 years old, highlighting notable changes in the quartiles:

Age (Years)	Lower Quartile (LQ)	Upper Quartile (UQ)
18	9.25	15.75
40	37.5	49.5

The table provides a clear comparison of the lower and upper quartiles for Ki67 positive nuclei at different ages, highlighting the substantial increase in the number of Ki67 positive nuclei at 40 years old.

Table 3: Current DNA Sequence of Patient X's APC1 Gene

The table below presents the current DNA sequence of patient X's APC1 gene, highlighting a point mutation in codon 280 and codon 1338:

Codon	Allele 1	Allele 2
280	TCA	TGA
1338	TAG	CAG

In codon 280, a mutation is observed due to changes in the mother's allele, leading to an inherited germline mutation. Codon 1338 exhibits a somatic mutation that occurred at 40 years old, resulting in a higher likelihood of developing polyps. Codon 280 represents a germline mutation and is classified as a nonsense point mutation (¹¹Nishisho et al., 1997). It is an autosomal disease, meaning that a mutation in the allele can lead to the disease.

Appendix: Current DNA Sequence from Patient X, Allele 1

Here is the full DNA sequence of allele 1 from patient X:

ATTCAGCAAATCGAAAAGGACATACTTCGTATACGACAGCTTTTACAGTCCCAAGCAACA 
GAAGCAGAGAGGTCATCTCAGAACAAGCATGAAACCGGCTCACATGATGCTGAGCGGCAG 
AATGAAGGTCAAGGAGTGGGAGAAATCAACATGGCAACTTCTGGTAATGGTCAGGGTTCA 
ACTACACGAATGGACCATGAAACAGCCAGTGTTTTGAGTTCTAGTAGCACACACTCTGCA 
CCTCGAAGGCTGACAAGTCATCTGGGAACCAAGGTGGAAATGGTGTATTCATTGTTGTCA 
ATGCTTGGTACTCATGATAAGGATGATATGTCGCGAACTTTGCTAGCTATGTCTAGCTCC 
CAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTA 
CATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG 
GCCAGGGCCAGTGCAGCACTCCACAACATCATTCACTCACAGCCTGATGACAAGAGAGGC 
AGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGCGCTTACTGTGAAACCTGT 
TGGGAGTGGCAGGAAGCTCATGAACCAGGCATGGACCAGGACAAAAATCCAATGCCAGCT 
CCTGTTGAACATTAGATCTGTCCTGCTGTGTGTGTTCTAATGAAACTTTCATTTGATGAA 
GAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTATTGCAA 
GTGGACTGTGAAATGTATGGGCTTACTAATGACCACTACAGTATTACACTAAGACGATAT 
GCTGGAATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAGGCTACGCTATGC 
TCTATGAAAGGCTGCATGAGAGCACTTGTGGCCCAACTAAAATCTGAAAGTGAAGACTTA

Discussion

Patient X exhibited a family history of colon cancer, raising concerns about their susceptibility to developing colorectal cancer, as it can be inherited (¹²El Fakir S et al., 2013). The presence of symptoms and the development of polyps, as shown in Figures 1a and 1b, strongly suggested Familial Polyposis Coli (FAP), an inherited condition.

The APC gene, known as a tumor suppressor gene, can lead to Familial Polyposis Coli (FAP) when mutations occur. A BLAST search tool was employed to analyze the provided genetic sequence. BLAST searches compare biological sequence information, such as amino acid sequences of proteins or nucleotides in DNA/RNA sequences. In this case, BLASTX was utilized to analyze amino acid sequences. The BLAST results identified the sequence as "Adenomatous polyposis coli protein isoform h (Homo sapiens)" with a mutation indicated by an asterisk. Patient X's mutation in the base led to the absence of codon q, resulting in the absence of the amino acid alanine.

The highlighted sequence segment above reveals a mutation, specifically a stop codon (TAG), indicating that everything following TAG will not be transcribed. This results in the production of a shortened protein. Additionally, there is a mutation in Table 1 where TCA point mutates to TGA. TCA normally codes for a serine amino acid, and a mutation of this codon can lead to the development of osteoma of the mandible, a condition linked to Gardner's syndrome. Gardner's syndrome is characterized by the presence of colon polyps and tumors external to the colon.

The results from the BLAST analysis suggest that the patient may inherit colon cancer due to mutations in the Adenomatous polyposis coli protein, a tumor suppressor. When mutated, this gene cannot effectively protect against tumors and carry out its function properly. Additionally, codon 1338's somatic mutation indicates a potential influence of external factors.

Figure 1b displays a tubular adenoma and the presence of a polyp in the histopathological section, indicating that the patient has developed polyps and is at an increased risk of developing colon cancer (¹³Markowitz et al., 2009). This observation is further supported by Figure 2, an immunofluorescence figure that illustrates beta-catenin levels through fluorescence. Increased fluorescence indicates higher levels of beta-catenin. Mutated APC allows the destruction complex to inactivate proteins by attaching ubiquitin and disintegrating beta-catenin into the proteasome. The elevated beta-catenin levels in Figures 4 and 3 suggest increased cell proliferation. The sudden increase in Ki67, as shown in Figure 4b, is associated with cancer aggressiveness, indicating an increased risk of cancer development.

A box plot was generated to determine the median number of Ki67 positive nuclei between the patient at 18 and 40 years old. The results presented in Table 2 reveal a significant increase in the number of Ki67 positive nuclei when the patient is 40 years old. The difference between the upper quartiles for both ages is 35, with the patient at 40 having a significantly higher upper quartile (53) compared to 18 (18). Comparing the medians, the median at 40 years old (41.7) is higher than at 18 years old (12.1).

Based on the gathered information, it is apparent that the patient is at a high risk of developing colon cancer, particularly given their family history and the presence of polyps. Treatment options include colonoscopy, sigmoidoscopy, and the Cologuard test, which uses blood to detect abnormalities.

Conclusion

In conclusion, the findings indicate that the patient is at an elevated risk of developing colon cancer. However, these mutations appear to be short-lived. If left untreated, the polyps may progress, increasing the likelihood of colon cancer development.

References

Cooper, G. M. (2019). The Development and Causes of Cancer. Retrieved from https://www.ncbi.nlm.nih.gov/books/NBK9963/
National Cancer Institute. (2019). NCI Dictionary of Cancer Terms. Retrieved from https://www.cancer.gov/publications/dictionaries/cancer-terms/def/digestive-system
Kapoor, Vinay Kumar (13 Jul 2011). Gest, Thomas R. (ed.). Large Intestine Anatomy: Gross Anatomy, Histology, Natural Variants. Retrieved from https://emedicine.medscape.com/article/1948929-overview
Aghabozorgi, A., Bahreyni, A., Soleimani, A., Bahrami, A., Khazaei, M., Ferns, G., Avan, A. and Hassanian, S. (2019). Role of adenomatous polyposis coli (APC) gene mutations in the pathogenesis of colorectal cancer; current status and perspectives.
Polakis, P. (2019). The adenomatous polyposis coli (APC) tumor suppressor. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/9196022
Croner, R., Brueckl, W., Reingruber, B., Hohenberger, W. and Guenther, K. (2019). Age and manifestation related symptoms in familial adenomatous polyposis.
Claes K, et al. (2019). The genetics of familial adenomatous polyposis (FAP) and MutYH-associated polyposis (MAP). Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/22103048
Clevers, H. (2019). Wnt/β-Catenin Signaling in Development and Disease.
Brown, K. et al. (2019). Ki67 protein: the immaculate deception? Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/11903593
Shirendeb U, Hishikawa Y, Moriyama S, et al. (2009). Human papillomavirus infection and its possible correlation with p63 expression in cervical cancer in Japan, Mongolia, and Myanmar. Acta Histochem Cytochem. 42:181–190.
Nishisho I, et al. (2019). Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/1651563
El Fakir S, et al. (2019). [Cancer screening practices of general practitioners working in the Fez Prefecture health center]. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/24418432/
Markowitz SD, Bertagnolli MM (December 2009). 'Molecular origins of cancer: Molecular basis of colorectal cancer'. The New England Journal of Medicine. 361 (25): 2449–60. doi:10.1056/NEJMra0804588. PMC 2843693. PMID 20018966.