Now Accepting Apple Pay

Apple Pay is the easiest and most secure way to pay on StudyMoose in Safari.

Schmidtea Mediterranea: Observations and Experiments

The strain used for these experiments is the asexual Schmidtea mediterranea. The animals were kept in a dark room with a constant temperature of 20В°C. Medium was prepared by adding 1.6mM NaCl, 1mM of CaCl2, 1mM of MgSO4.nH2O, 0.1mM of MgCl2.6H2O, 0.1mM of KCl and 1.2mM of NaHCO3 to Milli-Q water. The medium was changed every seven days, along with the feeding of the animals using veal liver. The worms were starved for 7 days before the experiments.

Treatment with chemical inhibitors

Nonspecific inhibition of ROS was achieved with Diphenyleneiodonium chloride (DPI, Sigma Aldrich, D2926). This compound interferes with electron transporters to block ROS production. DPI is hydrophobic and therefore needs to be dissolved in dimethylsulfoxide (DMSO, Sigma Aldrich, 471267). Considering DMSO can have a neurotoxic effect in high concentrations, extra 0, 1% or 0, 33% DMSO-exposed control groups were added to account for this. Worms were exposed to 3ВµM or 10ВµM of DPI for 60 minutes prior to amputation and three days post-amputation or 3 hours (if combined with H2O2 detection).

Get quality help now
RhizMan
Verified writer

Proficient in: Biology

4.9 (247)

“ Rhizman is absolutely amazing at what he does . I highly recommend him if you need an assignment done ”

+84 relevant experts are online
Hire writer

To reversibly inhibit a more downstream part of the pathway: MEK and consequently ERK, PD0325901 (Calbiochem) was used. This compound needed to be dissolved in DMSO as well.

The animals were exposed to a 10ВµM PD0325901-solution for 60 minutes before amputation and four days after. Exposure solutions were changed daily and the medium for the controls was replaced every two days. After the treatment periods, planaria were gently washed and brought into fresh medium. Pictures were taken with a binocular loupe and a Nikon SMZ600 camera using Nikon NIS Elements software.

Get to Know The Price Estimate For Your Paper
Topic
Number of pages
Email Invalid email

By clicking “Check Writers’ Offers”, you agree to our terms of service and privacy policy. We’ll occasionally send you promo and account related email

"You must agree to out terms of services and privacy policy"
Check writers' offers

You won’t be charged yet!

Blastema size was measured and normalized to the total body size of the worms using ImageJ (v1, 49p, National Insitute of Health).

In vivo H2O2 stain The chemical compound Peroxy Orange 1 (PO1) was used to visualize the in vivo production of hydrogen peroxide (29). PO1 displays intracellular fluorescence by becoming orange in response to intracellularly produced hydrogen peroxide. H2O2 was visualized in control animals and animals with ROS inhibition by DPI. A regenerative (R-) wound or healing (H-) wound was inflicted on the worms before visualization. Imaging was performed at 15 minutes post wounding/amputation using a Nikon Eclipse 80i (Nikon Instruments, Melville, USA) fluorescence microscope. Whole Mount Immunohistochemistry (anti-synorf).

Fixation and processing of the planaria were performed as described by Fraguas et al. (26). The planaria were rehydrated via a series of ethanol washes. A central nervous system (anti-synorf) staining was set out to be performed, but due to COVID-19, this procedure did not take place. RNAi RNA interference was performed to knock-down ОІ-catenin. For this, double-stranded RNA was designed (a forward primer: GCTGGATTGTTGGTTGAGGT and a reverse primer: TGGTTGTGCATAATCGGAGA). Afterwards, 1000nM RNAi probes were synthesized and injected using the Nanoject II (Drummond Scientific, Broomall, PA, USA). Injection of planaria was executed for three consecutive days after which they were amputated and exposed to PD0325901 or medium. Controls were injected with Milli-Q water.

Statistical methods

Blastema size was first normalized to either the whole body size or to the size of a specific fragment. Next, groups were compared using a two-sample t-test or the one-way ANOVA. P-values smaller than 0, 05 were considered significant. Statistical analysis was performed using JMP Pro 14. RESULTS ERK is present in the regeneration pathway in a specific gradient along the anteroposterior axis. Considerable evidence suggests that ERK is needed for regeneration. To better understand the role of ERK in the regeneration process (Fig. 1), we focused on elucidating the presence of its gradient in S. mediterranea. First, the worms were cut in three pieces and exposed to PD0325901 to inhibit MEK, an upstream factor of ERK. Results on seven days post amputation (DPA) indicate that blastema formation is suppressed more radical towards the tail (Fig. 2a). In addition, anterior blastemas seemed to be more sensitive to the inhibition leading to a smaller overall blastema size in these fragments.

Next, we cut the worms into five pieces. The experiment revealed that blastemas were again more inhibited towards the tail of the worm. This trend was more outspoken in anterior blastema formation than in posterior blastema growth, where the decrease is more gradually (Fig. S1). To visualize the ERK gradient within a fragment, we performed an experiment where the worms were cut longitudinally. The planaria were again amputated and exposed to PD0325901. Regeneration was significantly reduced in trunk and tail parts compared to controls. In the head fragments, no significant difference was seen. The same observation was made in an extra experiment on 7DPA and on 14DPA, where no control was added but the decreasing blastema size was present from head to tail (Fig. S2). These observations indicate that the PD0325901-treatment worked and ERK is present in a decreasing gradient from tail to head. This differs from the obtained after cross-sectionally cutting the worms and from observations in other studies. ОІ-catenin rescues blastema formation in MEK-inhibited fragments.

ОІ-catenin has been hypothesized to play an important role in head formation. To determine the effects of blocking MEK combined with ОІ-catenin inhibition, we performed a knockdown for ОІ-catenin with the aid of RNA interference and exposed planaria to PD032590. Four different groups were used in this experiment. Group 1 was injected with Milli-Q water and placed in medium, this is the overall control group. Group 2 was injected with Milli-Q water and exposed to PD0325901 to determine the effects of MEK inhibition. Group 3 was injected with ОІ-catenin RNAi and kept in

Cite this page

Schmidtea Mediterranea: Observations and Experiments. (2020, May 08). Retrieved from https://studymoose.com/schmidtea-mediterranea-observations-and-experiments-essay

👋 Hi! I’m your smart assistant Amy!

Don’t know where to start? Type your requirements and I’ll connect you to an academic expert within 3 minutes.

get help with your assignment